Search
Yunlong Liu Lab
back BACK
Molecular Biology Workshop - resources - Yunlong Liu Lab

Resource

 

Nucleic Acids Research

http://nar.oxfordjournals.org/

by category: http://www.oxfordjournals.org/nar/database/c

 

DATABASE: The Journal of Biological Databases and Curation

http://database.oxfordjournals.org/

 

UCSC Genome Browser

            http://genome.ucsc.edu

 

 

Live Demo

 

Demo sequence:

 

ATGCACTTGAGCAGGGAAGAAATCCACAAGGACTCACCAGTCTCCTGGTC

TGCAGAGAAGACAGAATCAACATGAGCACAGCAGGAAAAGTAATCAAATG

CAAAGCAGCTGTGCTATGGGAGTTAAAGAAACCCTTTTCCATTGAGGAGG

TGGAGGTTGCACCTCCTAAGGCCCATGAAGTTCGTATTAAGATGGTGGCT

GTAGGAATCTGTGGCACAGATGACCACGTGGTTAGTGGTACCATGGTGAC

CCCACTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTG

TTGGAGAAGGGGTGACTACAGTCAAACCAGGTGATAAAGTCATCCCACTC

GCTATTCCTCAGTGTGGAAAATGCAGAATTTGTAAAAACCCGGAGAGCAA

CTACTGCTTGAAAAACGAGTAGGTTTCTGATGCTCTCCCTGCGCAGACAT

TGAGTTTGCAC

 

 

DNA – Restriction Enzyme

http://rna.lundberg.gu.se/cutter2/

 

DNA – Nucleotide sequence homology search

            http://blast.ncbi.nlm.nih.gov

 

RNA – Sequence translation

http://ca.expasy.org/tools/dna.html

 

RNA – mRNA secondary structure prediction

RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi)

mFOLD (frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi)

GeneBee (http://www.genebee.msu.su/services/rna2_reduced.html)

 

Gene regulation – Transcription factor binding sites

Match (http://www.gene-regulation.com/cgi-bin/pub/programs/match/bin/match.cgi)

TESS (http://www.cbil.upenn.edu/cgi-bin/tess/tess)

SignalScan (http://www-bimas.cit.nih.gov/molbio/signal/)

TFScan (http://mobyle.pasteur.fr/cgi-bin/portal.py?form=tfscan)

 

Gene regulation – microRNA binding sites

TargetScan (http://www.targetscan.org/)

Miranda (http://cbio.mskcc.org/mirnaviewer/)

PicTar (http://pictar.mdc-berlin.de/)

PITA (http://genie.weizmann.ac.il/pubs/mir07/mir07_data.html)

 

miR2Disease (http://www.miR2Disease.org)

 

Gene regulation – Alternative splicing

FAST-DB (http://www.fast-db.com/)

UCSC genome browser (http://genome.ucsc.edu)

 

Wikipage:

             https://compbio.iupui.edu/support/wiki/index.php/KB